fix heading issues

topics/introduction/tutorials/galaxy-intro-ngs-data-managment/tutorial.md

@@ -28,8 +28,6 @@ contributors:
 
 In this section we will look at practical aspects of manipulation of next-generation sequencing data. We will start with the FASTQ format produced by most sequencing machines and will finish with the SAM/BAM format representing mapped reads. The cover image above shows a screen dump of a SAM dataset.
 
-# Introduction to sequencing data
-
 ## FASTQ manipulation and quality control
 
 [FASTQ](https://en.wikipedia.org/wiki/FASTQ_format) is not a very well defined format. In the beginning various manufacturers of sequencing instruments were free to interpret FASTQ as they saw fit, resulting in a multitude of FASTQ flavors. This variation stemmed primarily from different ways of encoding quality values as described [on the Wikipedia article for FASTQ](https://en.wikipedia.org/wiki/FASTQ_format) (below you will find an explanation of quality scores and their meaning). Today, the [FASTQ Sanger](https://www.ncbi.nlm.nih.gov/pubmed/20015970) version of the format is considered to be the standard form of FASTQ. Galaxy is using FASTQ Sanger as the only legitimate input for downstream processing tools and provides [a number of utilities for converting FASTQ files](https://www.ncbi.nlm.nih.gov/pubmed/20562416) into this form (see **FASTQ Quality Control** section of Galaxy tools).
@@ -73,7 +71,7 @@ It is common to prepare pair-end and mate-pair sequencing libraries. This is hig
 
 Thus in both cases (paired-end and mate-pair) a single physical piece of DNA (or RNA in the case of RNA-seq) is sequenced from two ends and so generates two reads. These can be represented as separate files (two FASTQ files with first and second reads) or a single file were reads for each end are interleaved. Here are examples:
 
-#### Two single files
+### Two single files
 
 File 1
 
@@ -105,7 +103,7 @@ CACTACCGGGGTATCTAATCCTGTTCGCTCCCCACGCTTTCGTCCATC
 > Note that read IDs are **identical** in two files and they are listed in **the same** order. In some cases read IDs in the first and second file may be appended with `/1` and `/2` tags, respectively.
 {: .comment}
 
-#### Interleaved file
+### Interleaved file
 
 ```
 @1/1